Banner
Banner
Banner
Banner

Banner

Nauka > Sequencing > Standard starters
Standard starters    
Universal primers delivered by Genomed, free of charge.
(ref: Addgene Molecular Biology Reference)

idnamesequence 5' - 3' Tmdescription
335SpromoterCTATCCTTCGCAAGACCCTTC54.4°C
13AOX1GCAAATGGCATTCTGACATCC52.4°C
25AOX1GACTGGTTCCAATTGACAAGC52.4°C
4AC5ACACAAAGCCGCTCCATCAG53.8°C
111ACYCDuetUP1GGATCTCGACGCTCTCCCT55.4°C
5Alpha-factorTACTATTGCCAGCATTGCTGC52.4°C
6Amp-RATAATACCGCGCCACATAGC51.8°C
7AUG1ForwardCAATTTACATCTTTATTTATTAACG46.2°C
8AUG1ReverseGAAGAGAAAAACATTAGTTGGC49.2°C
9BGHrevTAGAAGGCACAGTCGAGG50.3°C
10Bglob-intron-FCTGGTCATCATCCTGCCTTT51.8°C
11Bglob-intron-RTTTGCCCCCTCCATATAACA49.7°C
12Bglob-pA-RTTTTGGCAGAGGGAAAAAGA47.7°C
5BRCA1_11BFCAAGGAGCCAACATAACAGATG53.0°C
84BRCA1_11HRGATGACGTCCTAGCTGTGTGAAG57.1°C
13CAT-RGCAACTGACTGAAATGCCTC51.8°C
14CMVForwardCGCAAATGGGCGGTAGGCGTG60.2°C
15CRE-RGCAAACGGACAGAAGCATTT49.7°C
16CYC1GCGTGAATGTAAGCGTGAC51.1°C
17DsRed1-CAGCTGGACATCACCTCCCACAACG60.8°C
18DsRed1-NGTACTGGAACTGGGGGGACAG58.3°C
19EBVReverseGTGGTTTGTCCAAACTCATC49.7°C
21EF-1aForwardTCAAGCCTCAGACAGTGGTTC54.4°C
22EGFP-CCATGGTCCTGCTGGAGTTCGTG58.6°C
23EGFP-NCGTCGCCGTCCAGCTCGACCAG64.2°C
24EXFP-RGTCTTGTAGTTGCCGTCGTC53.8°C
fD1AGAGTTTGATCCTGGCTCAG51.8°C
k1forpMalCGATGAAGCCCTGAAAGAC51.1°C
25GAL1AATATACCTCTATACTTTAACGTC48.8°C
26Gal10pro-FGGTGGTAATGCCATGTAATATG51.1°C
28GAL4-ADTACCACTACAATGGATGATGT48.5°C
155GAL4-BDTCATCGGAAGAGAGTAGTAACA51.1°C
27Gal4N-termGAGTAGTAACAAAGGTCAA44.6°C
29GFP-FGGTCCTTCTTGAGTTTGTAAC50.5°C
30GFP-RCCATCTAATTCAACAAGAATTGGGACAAC57.3°C
31GPDpro-FCGGTAGGTATTGATTGTAATTCTG52.3°C
105gt7g_mkGTAATACGACTCACTATAGGG50.5°C
117gT7_mkGTAATACGACTCACTATAGG47.7°C
32GW-3GCATGATGACCACCGATATG51.8°C
33GW-5AATCTCGCCGGATCCTAACT51.8°C
34H1TCGCTATGTGTTCTGGGAAA49.7°C
36HA-RTCTGGGACGTCGTATGGGTA53.8°C
37HATGAGGAGCACGCTCATGCCCAC60.2°C
38hGH-PA-RCCAGCTTGGTTCCCAATAGA51.8°C
39hrGFP-RTCCCCGAGTACCACTTCATC53.8°C
40hUBCpro-FTGAAGCTCCGGTTTTGAACT49.7°C
41IRES-FTGGCTCTCCTCAAGCGTATT51.8°C
42IRES-RCCTCACATTGCCAAAAGACG51.8°C
43L4440AGCGAGTCAGTGAGCGAG52.6°C
44LacI-RGGCATACTCTGCGACATCGT53.8°C
45LacZ-RGACAGTATCGGCCTCAGGAA53.8°C
46LexACGTCAGCAGAGCTTCACCATTG56.7°C
47LKO15GACTATCATATGCTTACCGT47.7°C
48LNCXAGCTCGTTTAGTGAACCGTCAGATC57.7°C
49Luc-FAGTCAAGTAACAACCGCGA48.9°C
50LucNrevCCTTATGCAGTTGCTCTCC51.1°C
52M13(-40)GTTTTCCCAGTCACGAC47.1°C
wieleM13fwdGTAAAACGACGGCCAGT47.1°C 
54M13pUCfCCCAGTCACGACGTTGTAAAACG57.1°C
55M13pUCrAGCGGATAACAATTTCACACAGG53.5°C
wieleM13revCAGGAAACAGCTATGAC44.6°C
k2malEprimerGGTCGTCAGACTGTCGATGAAGCC60.8°C
56MBP-FGATGAAGCCCTGAAAGACGCGCAG60.8°C
58MMLV-FATCAGTTCGCTTCTCGCTTC51.8°C
59mPGK-FCATTCTGCACGCTTCAAAAG49.7°C
60MSCVCCCTTGAACCTCCTCGTTCGACC60.6°C
61MSCV-revCAGCGGGGCTGCTAAAGCGCATGC64.2°C
62MT1-FGCTGTCCTCTAAGCGTCACC55.9°C
57MTForwardCATCTCAGTGCAACTAAA43.5°C
63mU6-FCAGCACAAAAGGAAACTCACC52.4°C
MycGCATCAATGCAGAAGCTGATCTCA55.7°C
65Neo-FCGTTGGCTACCCGTGATATT51.8°C
66Neo-RGCCCAGTCATAGCCGAATAG53.8°C
68Nmt1-FGCAATGTGCAGCGAAACTAA49.7°C
67NOS-FGCGTTCAAAAGTCGCCTAAG51.8°C
69OpIE2ForwardCGCAACGATCTGGTAAACAC51.8°C
70pACYC-FTGAAGTCAGCCCCATACGAT51.8°C
71pAd-CMVGCTAGAGATCTGGTACCGTC53.8°C
72pBABE3ACCCTAACTGACACACATTCC52.4°C
73pBABE5CTTTATCCAGCCCTCAC47.1°C
74pBADForwardATGCCATAGCATTTTTATCC45.6°C
75pBADReverseGATTTAATCTGTATCAGG41.2°C
76pBluescriptKSTCGAGGTCGACGGTATC49.5°C
77pBluescriptSKTCTAGAACTAGTGGATC42.2°C
78pBMN5GCTTGGATACACGCCGC51.9°C
79pBRforBamCTTGGAGCCACTATCGAC50.3°C
80pBRforEcoAATAGGCGTATCACGAGGC51.1°C
81pBRrevBamGGTGATGTCGGCGATATAGG53.8°C
83pCasper-FGGGTTTTATTAACTTACAT40.3°C
85pcDL-FGTTGCCTTTACTTCTAGGCCT52.4°C
116pCMV5FwdCGTTGACGCAAATGGGCGG55.4°C
115pCMV5RevCCTCCACCCCATAATATTATAGAAGGACAC60.3°C
86pENTR-FCTACAAACTCTTCCTGTTAGTTAG52.3°C
87pENTR-RATGGCTCATAACACCCCTTG51.8°C
pET_terTGCTAGTTATTGCTCAGCGG51.8°C
pET_upGATGCGTCCGGCGTAGA51.9°C
pFastBacFTATTCCGGATTATTCATACCGTC51.7°C
88pGEX3CCGGGAGCTGCATGTGTCAGAGG62.4°C
89pGEX5GGGCTGGCAAGCCACGTTTGGTG62.4°C
90pGP704-RAACAAGCCAGGGATGTAACG51.8°C
91pHybLexReverseGAGTCACTTTAAAATTTGTATACAC49.5°C
pJET12-FCGACTCACTATAGGGAGAGCGGC60.6°C
pJET12-RAAGAACATCGATTTTCCATGGCAG54.0°C
92pLTet-FACTGAGCACATCAGCAGGAC53.8°C
93pLXSN5CCCTTGAACCTCCTCGTTCGACC60.6°C
94pMRB101-FAAGATGCAGGCAGCTGAGTT51.8°C
95pMT2-FTTGCCTTTCTCTCCACAGGT51.8°C
96pMX-S1811GACGGCATCGCAGCTTGGATACAC60.8°C
97PolyhedrinforwaAAATGATAACCATCTCGC43.5°C
98PolyhedrinreverGTCCAAGTTTCCCTG41.9°C
99pQEpromoterCCCGAAAAGTGCCACCTG52.6°C
100pQEreversGTTCTGAGGTCATTACTGG48.9°C
101pREPForwardGCTCGATACAATAAACGCC48.9°C
106pRS-markerCGGCATCAGAGCAGATTGTA51.8°C
102Pry1CTTAGCATGTCCGTGGGGTTTGAAT57.7°C
103pTrcHisForwardGAGGTATATATTAATGTATCG44.6°C
104pTrcHisReverseGATTTAATCTGTATCAGG41.2°C
pZIPTCCTTTCCAGCGAGGTTCTA51.8°C
107RCAS-FACATGGGTGGTGGTATAGCGCTTGCG62.7°C
k3RevLRCACTTTGTACAAGAAAGCTGG50.5°C
Rluc-FCCAGGATTCTTTTCCAATGC49.7°C
rP2ACGGCTACCTTGTTACGACTT52.4°C
109RVprimer3CTAGCAAAATAGGCTGTCCC51.8°C
110SFFV-FATTGATTGACTGCCCACCTC51.8°C
SP6ATTTAGGTGACACTATAG41.2°C
114SV40-spliceRCACAAAGATCCGGACCAAAG51.8°C
112SV40pA-RGAAATTTGTGATGCTATTGC45.6°C
113SV40pro-FTATTTATGCAGAGGCCGAGG51.8°C
T3ATTAACCCTCACTAAAGGGA47.7°C 
T7TAATACGACTCACTATAGG44.6°C
T7gGTAATACGACTCACTATAGGG50.5°C
T7terGCTAGTTATTGCTCAGCGG51.1°C
T7termCTAGTTATTGCTCAGCGG48.0°C
118TacpromoterGAGCGGATAACAATTTCACACAGG55.7°C
119Tet-RGGCGAGTTTACGGGTTGTTA51.8°C
120TK-pA-RTTGTCTCCTTCCGTGTTTCA49.7°C
121Tn7-endGGGGTGGAAATGGAGTTTTT49.7°C
122TRC-FCAAGGCTGTTAGAGAGATAATTGGA54.4°C
123Ubx-FAACTCGTACTTTGAACAGGC49.7°C
124V5ReverseACCGAGGAGAGGGTTAGGGAT56.3°C
125WPRE-RCATAGCGTAAAAGGAGCAACA50.5°C
126XBG-RGACTCCATTCGGGTGTTC50.3°C
127XEF1aTTTCGCCCTAACTTCGTGAT49.7°C
128XpressForwardTATGGCTAGCATGACTGGT48.9°C
odwiedź nas na facebooku
© Copyright by Genomed S.A. Wykonanie: Delta Interactive